Nature, Volume 429Sir Norman Lockyer Macmillan Journals Limited, 2004 |
No interior do livro
Resultados 1-3 de 77
Página 273
... performed essentially as described25 . Prehybridizations and hybridizations were performed in 50 % formamide , 5x SSC , 5x Denhardt's solution , 1 % SDS , and 100 μg ml- ' boiled herring - sperm DNA at 42 ° C . The following [ y - 32P ] ...
... performed essentially as described25 . Prehybridizations and hybridizations were performed in 50 % formamide , 5x SSC , 5x Denhardt's solution , 1 % SDS , and 100 μg ml- ' boiled herring - sperm DNA at 42 ° C . The following [ y - 32P ] ...
Página 302
... performed according to the manufacturers ' protocols . Primers used for reverse transcription ( RT ) -PCR were as follows : mLIV1 ; 5 ' - AAAAATCCTAGAACTAGTCTAGGGAAAGGA - 3 ' ( sense ) , 5 ' - CCTTCAGCTCCTCTCGAGAGTAGCGCTGGC - 3 ...
... performed according to the manufacturers ' protocols . Primers used for reverse transcription ( RT ) -PCR were as follows : mLIV1 ; 5 ' - AAAAATCCTAGAACTAGTCTAGGGAAAGGA - 3 ' ( sense ) , 5 ' - CCTTCAGCTCCTCTCGAGAGTAGCGCTGGC - 3 ...
Página 317
... performed on each ~ 500 - bp segment as shown in Fig . 1b . Assembly reactions contained each primer at 30 nM and 1 × ExTaq mix ( Takara ) in a total of 25 μl . Amplification reactions contained each outer primer at 0.5 μM , 2.5 μl ...
... performed on each ~ 500 - bp segment as shown in Fig . 1b . Assembly reactions contained each primer at 30 nM and 1 × ExTaq mix ( Takara ) in a total of 25 μl . Amplification reactions contained each outer primer at 0.5 μM , 2.5 μl ...
Outras edições - Ver tudo
Palavras e frases frequentes
actin activity addition analysis animal applications areas associated authors B-cells biology candidates cells Centre climate close complex containing contribute COP1 core corresponding culture Department detection determine disease drug effects et al example experience expression factor field Figure function funding further gene genetic genome growth human increase indicate individual Institute interactions interests International involved laboratory leading levels limited materials measured mechanism Methods molecular Nature observed obtained organizer performed plants pollen population position potential predicted present production protein publishing record region regulation response role says Science scientific scientists selection sequence shown signal single species structure successful suggest Supplementary surface temperature transcription University western blot