Nature, Volume 428Sir Norman Lockyer Macmillan Journals Limited, 2004 |
No interior do livro
Resultados 1-3 de 64
Página 84
... containing kanamycin ( 50 μg ml1 ) and 0.7 % agar instead of phytogel . Histochemical localization of GUS activity GUS staining was carried out using a substrate solution containing 100 mM sodium phosphate pH 7 , 10 mM EDTA , 0.1 ...
... containing kanamycin ( 50 μg ml1 ) and 0.7 % agar instead of phytogel . Histochemical localization of GUS activity GUS staining was carried out using a substrate solution containing 100 mM sodium phosphate pH 7 , 10 mM EDTA , 0.1 ...
Página 100
... containing oligonucleotide ( CPD position is italicized ) with the following sequence : 5 ' - CCAGCTCGGTACCGGGTT AGCCTTTGGAGTCGACCTGCAGAAATT - 3 ′ ( Figs 1a , b , e , and 2a – c ) , 5′- GGCTTGTCACTATCGCGTT GCGCTACAGTAAGTG - 3 ′ ( Fig ...
... containing oligonucleotide ( CPD position is italicized ) with the following sequence : 5 ' - CCAGCTCGGTACCGGGTT AGCCTTTGGAGTCGACCTGCAGAAATT - 3 ′ ( Figs 1a , b , e , and 2a – c ) , 5′- GGCTTGTCACTATCGCGTT GCGCTACAGTAAGTG - 3 ′ ( Fig ...
Página 435
... contain the bar - code oligonucleo- tides22 ( Fig . 5a ) . To test the concept of siRNA bar - code screens , we used a ... ( containing the bar- code sequences ) . Figure 5a shows that the PCR fragments hybridize with high specificity to ...
... contain the bar - code oligonucleo- tides22 ( Fig . 5a ) . To test the concept of siRNA bar - code screens , we used a ... ( containing the bar- code sequences ) . Figure 5a shows that the PCR fragments hybridize with high specificity to ...
Índice
of genetically modified grain | 8 |
Just | 14 |
Medical editors urged to accept ethical code | 17 |
16 outras secções não apresentadas
Outras edições - Ver tudo
Palavras e frases frequentes
activity analysis antibody apoptosis applications assays atom Biol biology boson cancer candidates Cdh1 cell biology Centre China Chlb chromosome Cks1 clinical cloned complex culture cyclin cyclin E density disease domain drug e-mail effects experience Ferroplasma follicle function funding gene expression genetic genome GlcN6P hCDC4 Higgs boson human increase indicated infection ING4 Institute interactions kinetochores Laboratory mice microtubules molecular molecules mucus mutations myocardin Nature nature publishing group Naturejobs neurons observed ocean oocytes ovaries phase photon Phys polar population postdoctoral prion probe production protein PSI+ qubit rapamycin receptor recombination region riboswitches ribozyme rld1 RNA interference role scientific scientists sequence signal siRNA Skp2 species stem cells strains structure Supplementary Fig surface target temperature transfected tubulin tumour University wild-type yeast