Nature, Volume 427Sir Norman Lockyer Macmillan Journals Limited, 2004 |
No interior do livro
Resultados 1-3 de 80
Página 83
... containing 5 μM forskolin and 0.5 % fetal bovine serum ( FBS ) for 1 week . Rat NSCs were cultured in N2 medium containing FGF2 ( 20 ng ml ' ) as described's . Neural differentiation was initiated with N2 supplemented medium containing ...
... containing 5 μM forskolin and 0.5 % fetal bovine serum ( FBS ) for 1 week . Rat NSCs were cultured in N2 medium containing FGF2 ( 20 ng ml ' ) as described's . Neural differentiation was initiated with N2 supplemented medium containing ...
Página 442
... containing a headspace with 2 × 10 atm O2 ( 2μM dissolved ) , a slow decrease in culture viability was observed , and this decrease was more rapid with a greater concen- tration of O2 ( Fig . 1a ) . By contrast , B. fragilis cells grew ...
... containing a headspace with 2 × 10 atm O2 ( 2μM dissolved ) , a slow decrease in culture viability was observed , and this decrease was more rapid with a greater concen- tration of O2 ( Fig . 1a ) . By contrast , B. fragilis cells grew ...
Página 861
... containing the promoter and the first two nucleotides of the OXII coding sequence was amplified from genomic DNA by PCR with the primers 5 ' - GCGCGGATCCCGCTGGGATAATCTCAAAGG - 3 ′ and 5 ' - CGCGCTGCAGATAA TGTCGACGTTAGTTAAC - 3 ' , and ...
... containing the promoter and the first two nucleotides of the OXII coding sequence was amplified from genomic DNA by PCR with the primers 5 ' - GCGCGGATCCCGCTGGGATAATCTCAAAGG - 3 ′ and 5 ' - CGCGCTGCAGATAA TGTCGACGTTAGTTAAC - 3 ' , and ...
Outras edições - Ver tudo
Palavras e frases frequentes
acid activation analysis ANKTM1 antibody applications assays Astron Astrophys Biol biology Ca2+ Cancer candidate carbon Cell Biology Centre chromosome climate complex core crystal Department detected domain e-mail effect electron embryos experience expression formation FtsY function fusion loop galaxies gene genetic genome germ cells global globular cluster GTPase Hipparcos histone human imaging indicate Institute interactions interface kinase Laboratory Landau level magnesite magnetic Markuelia membrane molecular molecules mutant nature publishing group Naturejobs Notch Notch signalling observed orbital paracaspase pathway peptide phase Phys position postdoctoral programme protein quantum quantum dot receptor region residues sample scientific scientists sequence signal siRNA species star stem cells structure supernova supersolid Supplementary Information surface target Technology temperature translocation trimer ubiquitination University velocity vernalization VIN3 vinculin virus Vycor www.nature.com/nature